View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11555_low_16 (Length: 235)
Name: NF11555_low_16
Description: NF11555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11555_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 6577891 - 6578092
Alignment:
| Q |
17 |
aattgatgagggtgggttactgcagatgtgataaagagaaatgcagagaaaatcaaagaaccgctaagaaatcaaggaacccannnnnnnaattagagaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6577891 |
aattgatgagggtgggttactgcagatgtgataaagagaaatgcagagaaaatcaaagaaccgctaagaaatcaaggaacccatttttttaattagagaa |
6577990 |
T |
|
| Q |
117 |
ataactcatgtttaccatgtagaaaaagcaagtatttaacttgttgagctttgatagtgtgttttagcagaattctttttgatgattattaaaataggtt |
216 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6577991 |
ataactcatgtttaccatatagaaagagcaagtatttaacttgttgagctttgatagtgtgttttagcagaattctttttgatgattattaaaataggtt |
6578090 |
T |
|
| Q |
217 |
tc |
218 |
Q |
| |
|
|| |
|
|
| T |
6578091 |
tc |
6578092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University