View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11555_low_8 (Length: 311)
Name: NF11555_low_8
Description: NF11555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11555_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 48175061 - 48174878
Alignment:
| Q |
1 |
actttagactcgtctgcaaaatcattgtttagtataataagttccatttaaatgcagagagaatgaccaatgtcaaattgattgtgtctctctattgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
48175061 |
actttagactcgtctgcaaaatcattgtttagtataataagttccatttaaatgcagagagaatcaccaatgtcaaattgattttgtctctctattgaat |
48174962 |
T |
|
| Q |
101 |
gtgattttagtaactagacatgttttactattgagataacttaggtttgactcgaagtgaaaaaagttgattttgattaaatgt |
184 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48174961 |
gtgattttagaaactagacatgttttactattaagataacttaggtttgactcgaagtgaaaaaagttgattttgattaaatgt |
48174878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 182 - 293
Target Start/End: Complemental strand, 48174092 - 48173981
Alignment:
| Q |
182 |
tgttgaaaaacttgtactaacttttacaacaaaggttagaattagaagtctcacgttgagaagataaaagtgatcaatgtagtactaaagttatgatgct |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48174092 |
tgttgaaaaacttgtactaacttttacaacaaaggttagagttagaagtctcacgttgagaagataaaagtgatcaatgtagtactaaagttatgatgct |
48173993 |
T |
|
| Q |
282 |
ctcccacctaat |
293 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48173992 |
ctcccacctaat |
48173981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University