View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11556_high_4 (Length: 334)
Name: NF11556_high_4
Description: NF11556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11556_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 19 - 317
Target Start/End: Complemental strand, 51390279 - 51389981
Alignment:
| Q |
19 |
aaacgacacattaggcacaaacatttgaatcaaaatcaactcagcccaagccgcataacgtgacggaattaaaacaccgtaaacattcgtataatcatcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51390279 |
aaacgacacattaggcacaaacatttgaatcaaaatcaactcagcccaagccgcataacgtgacggaattaaaacaccgtaaacattcgtataatcatcc |
51390180 |
T |
|
| Q |
119 |
gattgcgagttaagaacaattttcatcgcaaacagaacaccagaaaaaccagcagcgtattcataataatatctatcataatcgaagaaaacaaacaacg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51390179 |
gattgcgagttaagaacaattttcatcgcaaacagaacaccagaaaaaccagcagcgtattcataataatatctatcataatcgaagaaaacaaacaacg |
51390080 |
T |
|
| Q |
219 |
atttagataaaactaggtttatactctgcgataaagcgagaagagaagctatcatagaagcgaattgaagacttcccatggaagattctaagtgaattc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51390079 |
atttagataaaactaggtttatactctgcgataaagcgagaagagaagctatcatagaagcgaattgaagacttccgatggaagattctaagtgaattc |
51389981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University