View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11556_low_5 (Length: 211)
Name: NF11556_low_5
Description: NF11556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11556_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 13 - 194
Target Start/End: Complemental strand, 50763863 - 50763682
Alignment:
| Q |
13 |
agcaaaggtacttctagcagcatgttctaatgaagatcagattgagcaggttactagtgtgattagaacgatgcacaaggatatgaagactgttttgcca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50763863 |
agcaaaggtacttctagcagcatgttctaatgaagatcagattgagcaggttactagtgtgattagaactatgcacaaggatatgaagactgttttgcca |
50763764 |
T |
|
| Q |
113 |
gtagcataagnnnnnnngttgttgctagtagtagcattagtttttgaacttcaagattatactagaaaaatataatatatct |
194 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
50763763 |
gtagcataagtttttttgttgttgctagtagtagcataagtttttgaacttcgagattatactagaaaaatataatatatct |
50763682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University