View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11557A_high_20 (Length: 249)

Name: NF11557A_high_20
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11557A_high_20
NF11557A_high_20
[»] chr2 (1 HSPs)
chr2 (36-225)||(14801654-14801843)


Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 36 - 225
Target Start/End: Complemental strand, 14801843 - 14801654
Alignment:
36 ttaagtaccaggcaaaataccgttatgatcaacaacaaaaattgaatcaaaaccaaagcagaacttgaataaaaattcaatccttatgagattaaatgag 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14801843 ttaagtaccaggcaaaataccgttatgatcaacaacaaaaattgaatcaaaaccaaagcagaacttgaataaaaattcaatccttatgagattaaatgag 14801744  T
136 tcttatgtggctgtgtgatcacaattattgcaaatggagcttcttaaattgtttattattgtaaatggaagcgttttcctaatatgaaca 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14801743 tcttatgtggctgtgtgatcacaattattgcaaatggagcttcttaaattgtttattattgtaaatggaagcgttttcctaatatgaaca 14801654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University