View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_high_21 (Length: 249)
Name: NF11557A_high_21
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_high_21 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 39630199 - 39629968
Alignment:
| Q |
13 |
aatatttggtatgctctaggcttcatctcatttaaatttgtctcaaacccatacattgtcaattgttttaaatgctggctagcttcttcgagttccaact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39630199 |
aatatttggtatgctctaggcttcatctcatttaaatttgtctcaaacccatacattgtcaattgttttaaatgctggctagcttcttcgagttccaact |
39630100 |
T |
 |
| Q |
113 |
tctttgttgttggtgtttggtggtcttggagaaataggaactcaagttgnnnnnnnaatgtttcgattccaacttaccatcttgccatggaagctcacaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
39630099 |
tctttgttgttggtgtttggtggtcttggagaaataggaactcaagttgtttttttaatgtttcgatttcaacttaccat-----catggaagctcacaa |
39630005 |
T |
 |
| Q |
213 |
cttataacacactttcaacatttactttccaagatca |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39630004 |
cttataacacactttcaacatttactttccaagatca |
39629968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University