View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_102 (Length: 338)
Name: NF11557A_low_102
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_102 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 37 - 316
Target Start/End: Original strand, 43417132 - 43417411
Alignment:
| Q |
37 |
ctcaagaatgatcattgcttaacaaacttgcaaatggcaaaacattaaacaaagtactatataacgctttctgtccttttcaataacaaacattcttcac |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43417132 |
ctcaagaatgatcattgcttaacaaacttgcaaatggcaaaacattaaacaaagtactatataacgctttctgtccttttcaagaacaaacattcttcac |
43417231 |
T |
|
| Q |
137 |
atgtgaccacaccaagttaatttacagaccgcttatgatatgatatatgcagcagctcgcagatctaactaagaaaacccatattttttgcaagagtcac |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43417232 |
atgtgaccacaccaagttaatttacagaccgcttatgatatgatatatgcagcagctcgcaggtctaactaagaaaacccatattttttgcaagagtcac |
43417331 |
T |
|
| Q |
237 |
aatattgtatatcacgtttatagaaaataatgtaattagaataattgtgtagcgtataacccaaacaacatgctagtatt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43417332 |
aatattgtatatcacgtttatagaaaataatgtaattagaataattgtgtagcgtataacccaaacaacatgctagtatt |
43417411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University