View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_110 (Length: 334)
Name: NF11557A_low_110
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_110 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 16 - 334
Target Start/End: Complemental strand, 36170699 - 36170381
Alignment:
| Q |
16 |
atatagcaactgatccacaaaaccataactcattaaaatacttacagagctagatgaagtaaaacacaaactttcaatagccctcattgttatttccttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170699 |
atatagcaactgatccacaaaaccataactcattaaaatacttacagagctagatgaagtaaaacacaaactttcaatagccctcattgttatttccttt |
36170600 |
T |
|
| Q |
116 |
gtttttgaagaatatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccgtttgcctaaccaactcatctccaaagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36170599 |
gtttttgaagaatatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccatttgcctaaccaactcatctccaaagg |
36170500 |
T |
|
| Q |
216 |
caatattctgaatgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcctcaaccataaa |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36170499 |
caatattctgaatgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcctcaaccatgaa |
36170400 |
T |
|
| Q |
316 |
tctcttaacttcctcaaca |
334 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36170399 |
tctcttaacttcctcaaca |
36170381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 16 - 67
Target Start/End: Original strand, 1286343 - 1286394
Alignment:
| Q |
16 |
atatagcaactgatccacaaaaccataactcattaaaatacttacagagcta |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1286343 |
atatagcaactgatccacaaaaccataactcattaaaatacttacagagcta |
1286394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University