View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_116 (Length: 327)
Name: NF11557A_low_116
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_116 |
 | |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 202 - 312
Target Start/End: Complemental strand, 38296826 - 38296716
Alignment:
| Q |
202 |
caatagggtgtgttgttgtcatggcttttaactacttgtagtgctgccnnnnnnngacagacttctctgtgatggcctgtttttatttctttggtattct |
301 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38296826 |
caatagggtgtgttgctgtcatggcttttaactacttgtagtgctgcctttttttgacagacttctctgtgatggcctgtttttatttctttggtattct |
38296727 |
T |
|
| Q |
302 |
attatttccat |
312 |
Q |
| |
|
||||||||||| |
|
|
| T |
38296726 |
attatttccat |
38296716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 8 - 110
Target Start/End: Complemental strand, 38297020 - 38296918
Alignment:
| Q |
8 |
ataaagatgttgtcttggaggtggatgctggataggacttatatcccgtcttgtcttttttacgaatggagttggaatctaaaactgtcttaaaagataa |
107 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
38297020 |
ataaaggtgttgtcttggaggtggatgctggataggactcataccccgtcttgtcttttttacgaatggagttggaatccaaaactgtcttgaaagataa |
38296921 |
T |
|
| Q |
108 |
tgc |
110 |
Q |
| |
|
||| |
|
|
| T |
38296920 |
tgc |
38296918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 8 - 86
Target Start/End: Original strand, 24018373 - 24018451
Alignment:
| Q |
8 |
ataaagatgttgtcttggaggtggatgctggataggacttatatcccgtcttgtcttttttacgaatggagttggaatc |
86 |
Q |
| |
|
|||||| ||| |||||||||||||||| ||||||| ||| || ||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
24018373 |
ataaaggtgtcgtcttggaggtggatgttggatagaactcatttcccgtcctgtcttttttacgaatggtgttggaatc |
24018451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 15 - 86
Target Start/End: Original strand, 59644 - 59715
Alignment:
| Q |
15 |
tgttgtcttggaggtggatgctggataggacttatatcccgtcttgtcttttttacgaatggagttggaatc |
86 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| | | ||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
59644 |
tgttgtcttggaggtggatgttggaatggactcacaccccatcttgtctttttagcgaatggtgttggaatc |
59715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University