View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_128 (Length: 312)
Name: NF11557A_low_128
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_128 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 27 - 294
Target Start/End: Original strand, 3543484 - 3543751
Alignment:
| Q |
27 |
cagaacctgtggtgcacatactttattggtgatattgagattagtgcttattttccttgttgcagaagcaagctgcagaatacatggagaagctccgtgg |
126 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3543484 |
cagaacttgtggtgcacatactttattggtgatattgagattagtgcttattttccttgttgcagaagcaagctgcagaatacatggagaagctccgtgg |
3543583 |
T |
|
| Q |
127 |
ggctgttctcaaatacattacagtttagtgtggatagtatgttttgtttcttactttattatcaccatttgtggaaaaccgtgccgtcgataattgtatc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3543584 |
ggctgttctcaaatacattacagtttagtgtggatagtatgttttgtttcttactttattatcaccatttgtggaaaactgtgccgtcgataattgtatc |
3543683 |
T |
|
| Q |
227 |
aaatatgcgatatataatactttctttgctatgatatcatagtaaatgagttgtaaattttgaaatac |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3543684 |
aaatatgcgatatataatactttctttgctatgatatcatagtaaatgagttgtaaattttgaaatac |
3543751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 58 - 108
Target Start/End: Original strand, 2220581 - 2220631
Alignment:
| Q |
58 |
atattgagattagtgcttattttccttgttgcagaagcaagctgcagaata |
108 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||| ||||| |||| |
|
|
| T |
2220581 |
atattgagattagtgattattttccttgttgtaaaagcaaactgcaaaata |
2220631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University