View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_145 (Length: 298)
Name: NF11557A_low_145
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_145 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 40684390 - 40684121
Alignment:
| Q |
18 |
acacatcccgttaggaaggcgactaaatattagtaacaatctaacatctaagccgttggcaatgattttgcttaaaatcgtattgtcaattttgctaatg |
117 |
Q |
| |
|
||||||| | |||| |||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
40684390 |
acacatcactttagaaaggagactaaatagtagtaacaatctaacatctcagccgttggcaatgattttgcttaaaatcgtatggtcaattttgctagta |
40684291 |
T |
|
| Q |
118 |
catgtgtgaggggtttagttggaccctcatcctagatgtcacccaaagaattatatacctgactataattctttggcttaacgatttgagcagaatttga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40684290 |
catgtgtgaggggtttagttggaccctcatcctagatgtcacccaaataattatatacttgactataattctttggcttgacgatttgagcagaatttga |
40684191 |
T |
|
| Q |
218 |
ttgttaattagtctgaacgcatgcgctttcagtgcaagttagtaaaaatcgatgaaacctaaacacaaaca |
288 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||| ||||||| |||| ||||||| |
|
|
| T |
40684190 |
ttgttaattagtctgaacgcatgcgctctcagtgcaagttag-aaaaatctatgaaacataaagacaaaca |
40684121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University