View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_162 (Length: 287)
Name: NF11557A_low_162
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_162 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 57 - 281
Target Start/End: Complemental strand, 34398076 - 34397854
Alignment:
| Q |
57 |
aagagggaatagttatttcagtccttggcaaaatatctgacttgggtctctcataaaaacaacgtagcttttaaccgagcatttatcgaaacattgtttt |
156 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |||| |||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34398076 |
aagagagaatagttatttcagtccttggcaaaatatttgacctgggtctc--ataaaaacaatgtagcttttaacctagcatttatcgaaacattgtttt |
34397979 |
T |
 |
| Q |
157 |
ttcttatggtatgtactattttctttcacagtcgattttgtcatcttgttgctatgttatgtaatcgaattaaaagataacggaacccctccaatgctct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34397978 |
ttcttatggtatgtactattttctttcacagtcgattttgtcatcttgttgctatgttatgtaatcgaattaaaagataatggaacccctccaatgctct |
34397879 |
T |
 |
| Q |
257 |
tgaatatgcaacaatggaggaaaac |
281 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34397878 |
tgaatatgcaacaatggaggaaaac |
34397854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 12 - 45
Target Start/End: Original strand, 36703138 - 36703171
Alignment:
| Q |
12 |
atgaacaaaaacagatgggagaaaaacgattatc |
45 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
36703138 |
atgaacaaaaacagatgggagaagaacgattatc |
36703171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University