View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_163 (Length: 286)
Name: NF11557A_low_163
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_163 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 13 - 280
Target Start/End: Complemental strand, 43099082 - 43098816
Alignment:
| Q |
13 |
gagatcaaagtgatcatttacccaaatatatttcttgttaaaaa-ctgcatttgtacagtatacttttatagaaatgcatgttcaactatatactaatgt |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43099082 |
gagattaaagtgatcatttacccaaatatatttcttgttaaaaaactgcatttgtacagtatacttttatagaaatgcatgttcaactata--ctaatgt |
43098985 |
T |
|
| Q |
112 |
aagtgtcatcaaatggtgagctagacctgacatacatgttttagacagtagtactatatgattttgcattttgcaagctgctgttagtctgttacatgtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43098984 |
aagtgtcatcaaatggtgagctagacctgacatacaagttttagacggtagtactatatgattttgcattttgcaagcagctgttagtctgttacatgtt |
43098885 |
T |
|
| Q |
212 |
ctagttttcgaactttattaaatgctgaccaaacttgtctcttttgcctgacattgttacagctagttt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43098884 |
ctagttttcgaactttattaaatgctgaccaaacttgtctcttttgcctgacattgttacagctagttt |
43098816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University