View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_188 (Length: 273)
Name: NF11557A_low_188
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_188 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 16634918 - 16634659
Alignment:
| Q |
1 |
gatgaataccgtcaaagacaagatcgtggatgaaaattaaaagaccaacaaaaactcat-gccagtatcgatcgagtggaataatatttatctaccagta |
99 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16634918 |
gatgaatactgtcaaagacaagatcgtggatgaaaattaaaagaccaacaaaaactcattgccagtatcga----gtggaataatatttatctaccagta |
16634823 |
T |
|
| Q |
100 |
atgttttcttttttacaagaaagtaagtctcgacgcaacgtgaaattgtttttatgcgattgaaaggtcacatattaagttcaagttttgaaaacatcat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| ||| |||||||||||||||||| ||| |
|
|
| T |
16634822 |
atgttttcttttttacaagaaagtaagtctcgacgcaaagtgaaattgttgttatgtgattgaaaggtcacggtttaggttcaagttttgaaaacaacat |
16634723 |
T |
|
| Q |
200 |
atagtggcaaaaaacatatcgcgtatgcggaaattttagtgcaccaagttgacctatatattct |
263 |
Q |
| |
|
|||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16634722 |
atagtgtaaaaaaacatattgcgaatgcggaaattttagtgcaccaagttgacctatatgttct |
16634659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University