View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_189 (Length: 273)
Name: NF11557A_low_189
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_189 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 251
Target Start/End: Original strand, 40684391 - 40684650
Alignment:
| Q |
7 |
tatggtgttgctgtagccactatttgacaacactttgtaatccagtgcattgcagaacaataatagcaatatgttcaaattccgctaagctataacacta |
106 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
40684391 |
tatggtgttgctatagccactatttgacaacactttgtaattaagtgcattgcagaacaataatagcaatatgttcaaattccgctatgctacaacacta |
40684490 |
T |
 |
| Q |
107 |
tnnnnnnnnngcagaatgctgtcattatacgatcgaaaaagccacagttagagacc----------------atgcactgtttgaagatggaaacaactt |
190 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
40684491 |
t--caaaaaagcagaatgctgtcattatacgatcgaaaaagccacagttagagaccttaaaatgtattatagatgcattgtttgaagatggaaacaactt |
40684588 |
T |
 |
| Q |
191 |
cggctttggaatttgtattcggaacagccagggagttatggtccaa-cacggactgggtggt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40684589 |
cggctttggaatttgtattcggaacagccagggagttatggtccaagcacggactgggtggt |
40684650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University