View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_191 (Length: 273)
Name: NF11557A_low_191
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_191 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 14 - 267
Target Start/End: Complemental strand, 7705340 - 7705096
Alignment:
| Q |
14 |
tcacttatgtagtagcagaagcaaaaaagcagttaaatagtgcacctctagccattgtcttttttgtttgaagatgtcttgcaaaagtcaatgctcttgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7705340 |
tcacttatgtagtagcagaagcaaaaaagtagttaaatagtgcacctctagccattgtcttttttgtttgaagatgtcttgcagaagtcaatgctcttgt |
7705241 |
T |
 |
| Q |
114 |
atgaatgagacttaagcttaagggatccacgacttatttttgtatgcatctctgaaaaacagactccgatgtccgaaacccgtacgaacgacatgtgtca |
213 |
Q |
| |
|
|||||| |||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
7705240 |
atgaat-----ttaagcttaagggatctacaacttatttttgtatgcatctctgaaaaacagactccgatgtccgacacccgt----acgacatgtgtca |
7705150 |
T |
 |
| Q |
214 |
gacaagtgtcccaannnnnnnatatttttctacgcttcaccactccttagacac |
267 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||| |||||||||||||| |
|
|
| T |
7705149 |
gacaagtgtcccaatttttttatatttttctaagcttcaacactccttagacac |
7705096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 125 - 166
Target Start/End: Complemental strand, 8149799 - 8149758
Alignment:
| Q |
125 |
ttaagcttaagggatccacgacttatttttgtatgcatctct |
166 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
8149799 |
ttaagcttaagggatccacaacttatttttgtatacatctct |
8149758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University