View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_198 (Length: 269)
Name: NF11557A_low_198
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_198 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 52 - 251
Target Start/End: Complemental strand, 32493178 - 32492983
Alignment:
| Q |
52 |
atggagaagagggtatgagttctcatcaatttatagaatgcatacatatagtttgttgtatgagaatatttcatggtcactaatgcccgctgcaagttgc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32493178 |
atggagaagagggtatgagttctcatcaatttatagaatgcatacatatagtttgtagtataagaatatttcatggtcactaatgcccgctgcaagttgc |
32493079 |
T |
|
| Q |
152 |
aaattaacgcgttcattgatgataaaattaagctgcaagctataaacctttcaccttttgagttttgacaatatattatattatagtgaccagttctcct |
251 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32493078 |
aaa----cgcgttcattgatgataaaattaagctgcaagctataaacctttcaccttttgagttttgacaatatattatattatagtgaccagttctcct |
32492983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 52 - 121
Target Start/End: Complemental strand, 28594934 - 28594864
Alignment:
| Q |
52 |
atggagaagagggtatgagttctcatcaatttatagaatgcatacatat-agtttgttgtatgagaatatt |
121 |
Q |
| |
|
|||||||||||| | ||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28594934 |
atggagaagaggatttgagttctcatgaatttatagaatgcatacatatgtgtttgttgtatgagaatatt |
28594864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 52 - 94
Target Start/End: Original strand, 28593004 - 28593046
Alignment:
| Q |
52 |
atggagaagagggtatgagttctcatcaatttatagaatgcat |
94 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
28593004 |
atggagaagagggtacgagttctcatcaatttatagcatgcat |
28593046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University