View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_217 (Length: 261)
Name: NF11557A_low_217
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_217 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 101 - 245
Target Start/End: Complemental strand, 34138767 - 34138624
Alignment:
| Q |
101 |
ttaccaactagcactagtacttgcttttctattaattaattcacgaataaaaatataaggaaacaatatatttaattatttagcatttattagcagtcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34138767 |
ttaccaactagcactagtacttgcttttctattaattaattcacgaataaaaatataaggaagcaatatattt-attatttagcatttattagcagtcaa |
34138669 |
T |
|
| Q |
201 |
agttttctagagtgctattttttcacattctttgttcgttggttc |
245 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34138668 |
agttttctagagtgatattttttcacattctttgttcgttggttc |
34138624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 34138870 - 34138792
Alignment:
| Q |
1 |
aggtttgaaaatgaaaaaggttggtgaatatgccttgcctacctcactacttatttagttatttatatggttttgttctgtt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||| | || |||||||||||||||||||||||| |
|
|
| T |
34138870 |
aggtttgaaaatgaaaaaggttggtgaatatgccttgcct---tgactacctcactacttatttatatggttttgttctgtt |
34138792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University