View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_221 (Length: 259)
Name: NF11557A_low_221
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_221 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 34 - 163
Target Start/End: Original strand, 7509053 - 7509182
Alignment:
| Q |
34 |
ttccttttcctattcttcttcctttgcaatttactgatgtggaatttgtcaaactcttgctttggtaaatcaaatttcttcctctccccattttgaattg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7509053 |
ttccttttcctattcttcttcctttgcaaattactgatttggaatttgtcaacctcttgctttggtaaatcaaatttcttcctctccccattttgaattg |
7509152 |
T |
|
| Q |
134 |
cattaaggagaatggtggcaccttgcttca |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7509153 |
cattaaggagaatggtggcaccttgcttca |
7509182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 97 - 163
Target Start/End: Complemental strand, 27241558 - 27241492
Alignment:
| Q |
97 |
ggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggtggcaccttgcttca |
163 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||| ||| |||| |
|
|
| T |
27241558 |
ggtaaatcaaatttcttcctctcaccattttgaattgcattaagaagaatggtgacacattgattca |
27241492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 77 - 150
Target Start/End: Complemental strand, 27249183 - 27249111
Alignment:
| Q |
77 |
atttgtcaaactcttgctttggtaaatcaaatttcttcctctccccattttgaattgcattaaggagaatggtg |
150 |
Q |
| |
|
||||| ||||||||| ||| ||| |||| |||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
27249183 |
atttgacaaactctt-cttgggttaatcgaatttcttcctctcgccattttgaattgcattaagaagaatggtg |
27249111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University