View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_223 (Length: 258)
Name: NF11557A_low_223
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_223 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 7 - 166
Target Start/End: Complemental strand, 6515182 - 6515023
Alignment:
| Q |
7 |
aagaatattggatttacatggtgtcatcagtgtaacatctttcacatcatgtaatggttcccaagctttgtttgcatctttgaatggtttcctttataaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6515182 |
aagaatattggatttacatggtgtcatcagtgtaacatctttcatatcatgtaatggttcccaggctttgtttgcatctttgaatggtttcctttataaa |
6515083 |
T |
|
| Q |
107 |
gtaatgagacaagaaaatacacaacatcatataattagtaaagtaaaactttaaggttca |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6515082 |
gtaatgagacaagaaaatacacaacatcatataattagtagagtaaaactttaaggttca |
6515023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 175 - 258
Target Start/End: Complemental strand, 6514230 - 6514147
Alignment:
| Q |
175 |
aaaaaatgaccccaaaaatgatacgagggaccaaagtccataaaaacttaatttggaggggaaaaacggattttaagataatga |
258 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6514230 |
aaaaaatgaccccaaaaatgatacgaggaaccaaagttcataaaaacttaatttggaggggaaaaacggtttttaagataatga |
6514147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University