View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_236 (Length: 253)
Name: NF11557A_low_236
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_236 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 4885334 - 4885098
Alignment:
| Q |
17 |
gaaatcagtggcagcatcaaagcaagtgaaatcatgaaaacatacccaaaacatgttctcaagaaaccttcttcaccttcaacacaagatggcggagttg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4885334 |
gaaatcagtggcagcatcaaagcaagtgaaatcatgaaaacatacccaaaacatgttctcaagaaaccttcttcaccttcaacacaagatggcggtgttg |
4885235 |
T |
|
| Q |
117 |
ttcctaagatcgttgttgtccctcccgatgctgatcttcaacgcggtaagatttacttcctcatgcctctccctacaccgccaccaccggataaaaataa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4885234 |
ttcctaagatcgttgttgtccctcccgatgctgatcttcaacgcggtaagatttacttcctcatgcctctccctacgccgccaccaccggataaaaataa |
4885135 |
T |
|
| Q |
217 |
tcaccgtcatagcaaaaactcgtcggtaagaaagaaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885134 |
tcaccgtcatagcaaaaactcgtcggtaagaaagaaa |
4885098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University