View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_238 (Length: 252)
Name: NF11557A_low_238
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_238 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 31699040 - 31698803
Alignment:
| Q |
1 |
acaaggatttaagagcatcggacatgcttgcttttcatttctgatgccttacaatcagcctaaaatggatttcagatccaaggagtgtattttttggttt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31699040 |
acaaggatttaagaacatcggacatgcttgcttttcatttctgatgccttacaatcagcctaaaatggatttcagatccaaggagtgtatttttgggttt |
31698941 |
T |
|
| Q |
101 |
atcacacaatcacaaagggtgcaaatgtcttgcaagatggttgcatctgggcatttaagtatgttatgttaaatgagtattggtttccatatccaatcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31698940 |
atcacacaatcacaaagggtgcaaatgtcttgcaagatggttgcatctgggcatttaaggatgttatgttaaatgagtattggtttccatatccaatcct |
31698841 |
T |
|
| Q |
201 |
atttcacacttcttctatgtctccatctacctcttcatct |
240 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31698840 |
atttcacacttcttc--tgtctccatctacctcttcatct |
31698803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University