View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_239 (Length: 252)
Name: NF11557A_low_239
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_239 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 15 - 237
Target Start/End: Original strand, 43797915 - 43798137
Alignment:
| Q |
15 |
gaaaagtttaaagggatgtaatcctactagtgtagtgggttggtgcttaattaacaagattcttagtttgctatcgatggattgggaggttagagtttgt |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43797915 |
gaaaaatttaaagggatgtaatcctactagtgtagtgggttggtgcttaattaacaagattcttagtttgcttgcgatggattgggaggttagagtttgt |
43798014 |
T |
|
| Q |
115 |
gactagtattgtgcagctaattgatgtgtttatgctcttgttaatatggggtgcgatagcgaggacgcttgaatactttttgagttatgtcttgttcaaa |
214 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43798015 |
gactagtattgtgcagctaattaatgtgtttatgctcttgttaatatggggtgcgatagcgaggacgcttgaatactttttgagttatgtcttgttcaaa |
43798114 |
T |
|
| Q |
215 |
ctagttggttcgtcattattgat |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43798115 |
ctagttggttcgtcattattgat |
43798137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University