View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_243 (Length: 251)
Name: NF11557A_low_243
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_243 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 29280298 - 29280366
Alignment:
| Q |
1 |
tagtgagtcaacataagttcttggaccatggtactaatttggttacgtgtattctttttgattgagtat |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||| |
|
|
| T |
29280298 |
tagtgagtcaacataagttcttggaccatggtactaatttgtttacttttattctttttgattgagtat |
29280366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 195 - 236
Target Start/End: Original strand, 29280492 - 29280533
Alignment:
| Q |
195 |
cctaaaccactagaaccatgtgtgctttttgtggatttgcat |
236 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
29280492 |
cctaaaccaccagaaccatgtgtactttttgtggatttgcat |
29280533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University