View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_268 (Length: 249)
Name: NF11557A_low_268
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_268 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 45123340 - 45123580
Alignment:
| Q |
1 |
agtattattttctagttgttattggacaatgatcatagtttcgtctccgctttttgaagtttccacctatgttgtgattgtgtttctttattttctctat |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45123340 |
agtattattttctagttgtcattggacaatgatcatagtttcgtctccgctttttgaagtttctacctatgttgtgattgtgtttctttattttctctat |
45123439 |
T |
 |
| Q |
101 |
gttgatcttttccaacacaattttgtcttcaactatgaaaaatgtttctcaaatgtatccttctatgaatgtctattacagaatattatgaatattagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45123440 |
gttgatcttttccaacacaattttgtcttcaactatgaaaaatgtttctcaaatatatccttctatgaatgtctattacaaaatattatgaatattagtg |
45123539 |
T |
 |
| Q |
201 |
atgatgtattgattaaatgtatttttaacggtcttcatctc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45123540 |
atgatgtattgattaaatgtatttttaacggtcttcatctc |
45123580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University