View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_271 (Length: 249)
Name: NF11557A_low_271
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_271 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 50 - 245
Target Start/End: Original strand, 10155574 - 10155769
Alignment:
| Q |
50 |
atagagttatagagttatagacctgtaacatagtctatgtcatattaatgtctggtcatgctattttattaaataaacgagaccaatgcatttttaaaaa |
149 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10155574 |
atagagttatagagttatagacctataacatagtctatgtcatattcatgtcaggtcagactattttattaaataaactagaccaatgcatttttaaaaa |
10155673 |
T |
|
| Q |
150 |
catatttagcttattagcnnnnnnnnncatatttagctaatatcactcggattacaaactacctaaaaggcctttaaacatatcagaataatctac |
245 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
10155674 |
catatttagcttattagcaaaaaaaaacatatttagctaatatcactcggattacagactacctaaaaaacctttaaacatatcagactaatctac |
10155769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University