View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_278 (Length: 247)
Name: NF11557A_low_278
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_278 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 7617737 - 7617568
Alignment:
| Q |
1 |
aattgttatgtgtagctgcatataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttctgtc |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617737 |
aattgttatgtgtagttgcatataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttctgtc |
7617638 |
T |
|
| Q |
101 |
tttaaagtgnnnnnnnnnccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgc |
172 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617637 |
tttaaagtg--aaaaaaaccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgc |
7617568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University