View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_281 (Length: 246)
Name: NF11557A_low_281
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_281 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 26610153 - 26610385
Alignment:
| Q |
1 |
tcatattgcgaaaaatatggtcaatgtagttgcaatgttgttttggagacctcaaaatcttcaatagtacannnnnnnnaagggaaatagtacagttgta |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26610153 |
tcatattgcgaaaaatgtggtcaatgtagttgcaatgttgttttggagacctcaaaatcttcaatagtacattttttt-aagggaaatagtacagttgta |
26610251 |
T |
 |
| Q |
101 |
gactataatttaaaccaatggttgtaccggttatgtggatttatgtagagacccgagtttgatttgtatataatacatttttgaagtaggttaacaaaaa |
200 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26610252 |
gactgtaatttaaaacaatggttgtaccggttatgtggatttatgtagagacccgagtttgatttgtatataatacatttttgaagtaggttaacaaaaa |
26610351 |
T |
 |
| Q |
201 |
ttaaatgtttgtttgtcttcacggtgaatatatt |
234 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
26610352 |
ttaagtgtttgtttgtcttcacggtgaatatatt |
26610385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University