View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_284 (Length: 246)
Name: NF11557A_low_284
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_284 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 25 - 237
Target Start/End: Original strand, 38932026 - 38932238
Alignment:
| Q |
25 |
tgaatcatttatatataacaaagttggttgcatttaggagtaattgttagattataattaatgttgcttactcttgggatacgatcgagttggtttagtt |
124 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932026 |
tgaatgatttatatataacaaagttggttgcatttaggagtaattgttagattataattaatgttgcttactcttgggatacgatcgagttggtttagtt |
38932125 |
T |
|
| Q |
125 |
tattagaagtgtcgaggagagtgacaataataagcggggtattgccgtaattgtaggtccagtaaggaacaccaggtggaatagcaataaggtcaccctg |
224 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932126 |
tattggaagtgtcgaggagagtgacaataataagaggggtattgccgtaattgtaggtccagtaaggaacaccaggtggaatagcaataaggtcaccctg |
38932225 |
T |
|
| Q |
225 |
tttcacataacga |
237 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38932226 |
tttcacataacga |
38932238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University