View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_285 (Length: 245)
Name: NF11557A_low_285
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_285 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 10 - 241
Target Start/End: Complemental strand, 10427370 - 10427139
Alignment:
| Q |
10 |
agtattaaccctaagttttcaaagtatatactacatcaacagctaagcattgtgcaacttcaaggcccacataacctaccaattttttgttctcaacttc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10427370 |
agtattaaccctaagttttcaaagtatatactacatcaacagctaagcagtgtgcaacttcaaggcccacataacctaccaattttttgttctcaacttc |
10427271 |
T |
|
| Q |
110 |
aatgtgttgaaatatcaatgaaattgaatcaacatattatacccgtaagaaagttgaatgatatatattagttttcctagtaaagtttaattcacttaca |
209 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10427270 |
aatgtgtcgaaatatcaatgaaattgaatcaacatattatacccgtaagaaagttgaatgatatatattagttttcctagtaaagtttaattcacttaca |
10427171 |
T |
|
| Q |
210 |
gctatatatatgtcttctactaagtatattgt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10427170 |
gctatatatatgtcttctactaagtatattgt |
10427139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University