View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_289 (Length: 245)
Name: NF11557A_low_289
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_289 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 59 - 170
Target Start/End: Original strand, 43921985 - 43922096
Alignment:
| Q |
59 |
tagaatcgacaagatactagtggtgcaattacggattctaatgcgatcgatgataataagagaggtgaaatgaataaaaaaggagatagaaattgaaacc |
158 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43921985 |
tagaatcgataagatactagtggtgcaattacggattctagtgcgatcgatgataataagagaggtgaaatgaataaaaaaggagatagaaattgaaacc |
43922084 |
T |
|
| Q |
159 |
ttgattttcatc |
170 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43922085 |
ttgattttcatc |
43922096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University