View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_295 (Length: 244)
Name: NF11557A_low_295
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_295 |
 | |
|
| [»] scaffold0025 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 6 - 220
Target Start/End: Complemental strand, 13112092 - 13111878
Alignment:
| Q |
6 |
tatggtgttggggaaaaatggaaagggtggtcgtcgaataaatggggtgtagggggaagaaagtcgaagggtgatttgaaggtgggtggtagcgtaggag |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
13112092 |
tatggtgttggggaaaaatgaaaagggtggtcgtcgaataaatggggtgtagggggaagaaagtcgaagggtgatttgaacgtgggtggtagcgaaggag |
13111993 |
T |
|
| Q |
106 |
tgacaagtttacggaggaagatggaagtagaaaacatgtgggagagtaataaagtaggtcaaggtgtttatcagttttcgggtggaggacaattggaaat |
205 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13111992 |
tgacaattttacgaaggaagatggaagtagaaaacatgtgggagagtaataaagtaggtcaaggtgtttatcagttttcgggtggaggacaattggaagt |
13111893 |
T |
|
| Q |
206 |
gttgttgcgtgtatg |
220 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
13111892 |
gttgttgcatgtatg |
13111878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 6 - 202
Target Start/End: Original strand, 150077 - 150272
Alignment:
| Q |
6 |
tatggtgttggggaaaaatggaaagggtggtcgtcgaataaatggggtgtagggggaagaaagtcgaagggtgatttgaaggtgggtggtagcgtaggag |
105 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
150077 |
tatggtgttggggaaaa-tggaaagggttgtcctcgaataaatggggtgtagggggaagaaagttgaagggtgatttgaaggtgggtggtagcgaaggag |
150175 |
T |
|
| Q |
106 |
tgacaagtttacggaggaagatggaagtagaaaacatgtgggagagtaataaagtaggtcaaggtgtttatcagttttcgggtggaggacaattgga |
202 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
150176 |
tgacaattttacggaggaagatggaagtagaaaacatgtgggtgagtaataaagtaggtcaaggtgtttatcagtttttgggtggaggacaattgga |
150272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University