View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_322 (Length: 238)
Name: NF11557A_low_322
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_322 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 4 - 238
Target Start/End: Complemental strand, 5726603 - 5726356
Alignment:
| Q |
4 |
atagtagactggaaaaagcatttctttaatttaattaagatattaacatatgccgacataatgaagcataaaatttagagttaatttttgcacccttaac |
103 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5726603 |
atagtagactgaaaaaagcatttctttaatttaattaagatattaacatatgccgacataatgaagcataaaatttagagttaatttttgcaaccttaac |
5726504 |
T |
|
| Q |
104 |
ttcttagtttttccttagcaaacaaataatgt--------------ctcgtagagattccttttgagttaattgatatcattttatgatattgacatatt |
189 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726503 |
ttcttagtttttccttagc-aacaaataatgtaacatctacgagcaattgcagagattccttttgagttaattgatatcattttatgatattgacatatt |
5726405 |
T |
|
| Q |
190 |
cgggtatatatttttcatatgcacaggtttaaattggaactccaaacta |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5726404 |
cgggtatatatttttcatatgcacaggtttaaattgaaactccaaacta |
5726356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University