View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_324 (Length: 238)
Name: NF11557A_low_324
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_324 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 39495614 - 39495413
Alignment:
| Q |
19 |
cagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaacttcatggtttagtgcttatgatttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495614 |
cagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaacttcatggtttagtgcttatgatttg |
39495515 |
T |
 |
| Q |
119 |
tgaatacaggcattgtgtagagtatatt--ggtaagctattatgcagtgttaatagtattagtaactgataattacataagttgttatgttagtcatcgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495514 |
tgaatacaggcattgtgtagagtatattggggtaagctattatgcagtgtgaatagtattagtaactgataattacataagttgttatgttagtcatcgt |
39495415 |
T |
 |
| Q |
217 |
at |
218 |
Q |
| |
|
|| |
|
|
| T |
39495414 |
at |
39495413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University