View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_335 (Length: 235)
Name: NF11557A_low_335
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_335 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 232
Target Start/End: Complemental strand, 53096853 - 53096639
Alignment:
| Q |
18 |
tctaacattattgccaggcttgaggattgcacataatgctgtttgtttgcagtaaatttcttttactcaacttcattttgaccttgttatgtagcctaat |
117 |
Q |
| |
|
|||||||||||||||||||| || | |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096853 |
tctaacattattgccaggctcgacgtatgcaactaatgcttcttgtttgcagtaaatttcttttactcaacttcattttgaccttgttatgtagcctaat |
53096754 |
T |
 |
| Q |
118 |
ttcctccacccccttcatttctgctcatccaaattcgatggannnnnnnncttaaggtcttctgctgccgctaaagctccacattggctgaatgctgcta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53096753 |
ttcctccacccccttcatttctgctcatccaaattcgatggattttttttcttaaggtcttctgctgccgctaaagctccacattggctgaatgctgcta |
53096654 |
T |
 |
| Q |
218 |
tttgcaactccaaac |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
53096653 |
tttgcaactccaaac |
53096639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University