View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_344 (Length: 232)
Name: NF11557A_low_344
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_344 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 210
Target Start/End: Original strand, 34344744 - 34344938
Alignment:
| Q |
16 |
agaatatccaaggtggctccaaatttgtctttgaaggaggatgcaaaggtttgaatagaatcagcatctgagacatcaaggactagaaagtgaacatgat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344744 |
agaatatccaaggtggctccaaatttgtctttgaaggaggatgcaaaggttttaatagaatcagcatctgagacatcaaggactagaaagtgaacatgat |
34344843 |
T |
 |
| Q |
116 |
gatgaggtgcaacaaggcctaattgtgctcgaatcatctccacagcatcctctcctttcttcttgtctctagcagttaacactacactcagtccc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34344844 |
gatgaggtgcaacaaggcctaattgtgctcgaattctctccacagcatcctctcctttcttcttgtctctagcagttaacactacactcagtccc |
34344938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University