View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_347 (Length: 232)
Name: NF11557A_low_347
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_347 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 6236589 - 6236364
Alignment:
| Q |
1 |
tataggattttgatgtaattctgctttttctgtttttgtttcttcctgatgtagaccttgttatgggttctggccctctctagttttattgaatttcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6236589 |
tataggattttgatgtaattctgccttttctatttttgtttcttcctgatgtagactttgttatgggttctggccctcttcagttttattgaatttcttc |
6236490 |
T |
|
| Q |
101 |
gcttgatcnnnnnnnnnnnnttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttc |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6236489 |
gcttgataaaaaaaaaaaaattagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttc |
6236390 |
T |
|
| Q |
201 |
tacttttgttgaatgtgggaacacta |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6236389 |
tacttttgttgaatgtgggaacacta |
6236364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 121 - 226
Target Start/End: Original strand, 33891807 - 33891908
Alignment:
| Q |
121 |
ttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
220 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33891807 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33891902 |
T |
|
| Q |
221 |
acacta |
226 |
Q |
| |
|
|||||| |
|
|
| T |
33891903 |
acacta |
33891908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 121 - 226
Target Start/End: Complemental strand, 33952441 - 33952340
Alignment:
| Q |
121 |
ttagattttcacctatcacctaggttttcaatttctattaactaaagcgaaaggggaaatatggtttcgtagacttcttctacttttgttgaatgtggga |
220 |
Q |
| |
|
||||||||||||| || | |||||||||||||| ||||||||| |||| ||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33952441 |
ttagattttcacccataaactaggttttcaatta----taactaaagtgaaaagggaaatatggtttctaggacttcttttacttttgttgaatgtgggg |
33952346 |
T |
|
| Q |
221 |
acacta |
226 |
Q |
| |
|
|||||| |
|
|
| T |
33952345 |
acacta |
33952340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University