View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_355 (Length: 230)
Name: NF11557A_low_355
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_355 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 7 - 198
Target Start/End: Original strand, 48020592 - 48020785
Alignment:
| Q |
7 |
aatgtaacatttcatgtttgttgtattgcacttatcattcagctggttttgaaagttgctatgatgtttttagtttatgattacacatgcttgatctttt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48020592 |
aatgtaacatttcatgtttgttgtattgcacttatcattcagctggttttgaaagttactatgatgtttttagtttatgattacacatgcttgatctttt |
48020691 |
T |
|
| Q |
107 |
atttatattgctcattgtcattttgattggtcttttaagggttagtatatctcaagtaccagctga--atcctgtgaataaattgttgttatca |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48020692 |
atttatattgctcattgtcattttgattgatcttttaagggttagtatatctcaagtaccagctgattatcctgtgaataaattgttgttatca |
48020785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University