View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_370 (Length: 230)
Name: NF11557A_low_370
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_370 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 21 - 224
Target Start/End: Complemental strand, 6514122 - 6513919
Alignment:
| Q |
21 |
taaatatataatttgtatcatacctgtttaaatcttcacaattaggagtatgagcaaaaagtttatttggctgcatcaattgatcattctgcaagagtgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6514122 |
taaatatataatttgtatcatacctgtttaaatcttcacaattaggggtatgagcaaaaagtttatttggctgcatcaattgatcattctgcaagagtgt |
6514023 |
T |
|
| Q |
121 |
aactatgtctcttataggtcctgttggtcgaatatgttgtacttttccttttgatataacatacaatgtgcttgatttaggcaatgacttagctaaggta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6514022 |
aactatgtctcttataggtcctgttggtcgaatatgttgtacatttccttttgatataacatacaatgtgcttgatttaggcaatgacttagctaaggta |
6513923 |
T |
|
| Q |
221 |
gatg |
224 |
Q |
| |
|
|||| |
|
|
| T |
6513922 |
gatg |
6513919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University