View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_384 (Length: 229)
Name: NF11557A_low_384
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_384 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 9 - 223
Target Start/End: Original strand, 48674011 - 48674225
Alignment:
| Q |
9 |
ttaatacattcctatgatttaaaagacgaatttgaatattaatttcatttttcattaaagaaaattatgatactcttgaatggttaacaaggtccaccac |
108 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48674011 |
ttaatacattcctataatttaaaagaccaatttgaatattaatttcatttttcattaaagaaaattatgatactcttgaatggttaacaaggtccaccac |
48674110 |
T |
 |
| Q |
109 |
tacctgataattgatgttgagaattatataatctagaccaatttcaataattcaatagattgtgtctggcaaccagtaagattcctcggttgcaatggaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48674111 |
tacctgataattgatgttgagaattatataatctagaccaatttcaataattcaatagattgtgtctggcaaccagtaagattcctcggttgcaatggaa |
48674210 |
T |
 |
| Q |
209 |
aggcttgtatggatc |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48674211 |
aggcttgtatggatc |
48674225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University