View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_389 (Length: 229)
Name: NF11557A_low_389
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_389 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 46301275 - 46301497
Alignment:
| Q |
1 |
acagctacatttttgttttctcatacttactctttgtggtttttgtctttctttgtaacaatggaagacgaaggcttaatgcctttgttctatgctaggc |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46301275 |
acagctacattttagttttctcatacttactctttgtggtttttgtctttctttgtaacaatggaagacgaaggcttaatgcctttgttctatgctaggc |
46301374 |
T |
|
| Q |
101 |
agaaaaaatggtggttccatgcgacaacaatgtttctcatgctgttgcttctttctccatttgcattttcacttcaggaagaaggtttgtgcttttgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46301375 |
agaaaaaatggtggttccatgcgacaacaatgtttctcatgctgttgcttctttctccatttgcattttcacttcaggaagaaggtttgtgcttttgtaa |
46301474 |
T |
|
| Q |
201 |
cttttattgtcatgtggagtaac |
223 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
46301475 |
ctattattgtcatgtggagtaac |
46301497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University