View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_397 (Length: 227)
Name: NF11557A_low_397
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_397 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 27099154 - 27098934
Alignment:
| Q |
7 |
gactcatcgccatccgcggtaaacagcctccaatgtgcagcctgcggctgtcaccggaacttccaccgcaaaataaccgcgatcacaagggagagtgccg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099154 |
gactcatcgccatccgcggtaaacagcctccaatgtgcagcctgcggctgtcaccggaacttccaccgcaaaataaccgcgatcacaagggagagtgccg |
27099055 |
T |
|
| Q |
107 |
cggctgctgcaatgtcggatcagatgatggaatattccggtggaggaggtaggggaagggatnnnnnnnnnaagaggtaccggacgaaatttacgccgga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
27099054 |
cggctgctgcaatgtcggatcagatgatggaatattccggtggaggaggtagtggaagtgatgggaggaggaagaggtaccggacgaaatttacgccgga |
27098955 |
T |
|
| Q |
207 |
tcagaaggggaagatgatggg |
227 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
27098954 |
tcagaaggagaagatgatggg |
27098934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University