View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_399 (Length: 227)
Name: NF11557A_low_399
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_399 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 6318118 - 6317898
Alignment:
| Q |
1 |
ttttatagcctcttggcattcaaacaagatatgtcaatcactttcattttccccttcacaaaaaggacaagaagtttgacattgtacccctcttgttatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6318118 |
ttttatagcctcttggcattcaaacaagatatgtcaatcactttcattttccccttcacaaaaaggacaagaagtttgacattgaacccctcttgttatg |
6318019 |
T |
|
| Q |
101 |
agtttttctctcgtctgcgatcaaccttttttggtactcttaacctccataactttgtccactcccctggttttctcaagtttacataaatcatatgacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6318018 |
agtttttctctcgtctgcgatcaaccttttttggtactcttaacctccataactttgtccactcccctggttttctcaagtttacataaatcatatgacc |
6317919 |
T |
|
| Q |
201 |
atatttcactgatcaagtttc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6317918 |
atatttcactgatcaagtttc |
6317898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 29 - 112
Target Start/End: Complemental strand, 55983990 - 55983907
Alignment:
| Q |
29 |
atatgtcaatcactttcattttccccttcacaaaaaggacaagaagtttgacattgtacccctcttgttatgagtttttctctc |
112 |
Q |
| |
|
|||||||||||||||||||||||| |||| | ||||||||| ||| |||||||||| ||||||| | ||||||||||||||||| |
|
|
| T |
55983990 |
atatgtcaatcactttcattttcctcttctctaaaaggacatgaaatttgacattgaacccctcgtcttatgagtttttctctc |
55983907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 127 - 164
Target Start/End: Complemental strand, 55983861 - 55983824
Alignment:
| Q |
127 |
ttttttggtactcttaacctccataactttgtccactc |
164 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55983861 |
ttttttggtactcttaacctccacaactttgtccactc |
55983824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University