View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_405 (Length: 225)
Name: NF11557A_low_405
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_405 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 24 - 208
Target Start/End: Original strand, 17811965 - 17812148
Alignment:
| Q |
24 |
agcatggttccgttgagtcgtctgttgcaggttcttctccactggaagggggatggtgtacctgcactgcacgcgctccgacactctctttcttgaaccc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| | |||| |||| ||||||||||||||| |
|
|
| T |
17811965 |
agcatggttccgttgagtcgtctgttgcaggttcttctccaccggaaggggggtggtgtacctgcactgcatgtgctctgaca--ctctttcttgaaccc |
17812062 |
T |
 |
| Q |
124 |
ctcacttctccagccatctatgcctggggtacggacatgagtaa-ccctcggggtggtaaggagctctcggattaatggtgaggaa |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17812063 |
ctcacttctccagccatctattcctggggtacggacatgagtaacccctcggggtggtgaggagctctcggattaatggtgaggaa |
17812148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University