View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_406 (Length: 225)
Name: NF11557A_low_406
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_406 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 3675535 - 3675349
Alignment:
| Q |
20 |
atatgatgggtttttgtcaaaatttaatttgtatggaactttaattaataannnnnnnaatcttaggtatttgcttgtggtagcattttttacaagtata |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675535 |
atatgatgggtttttgtcaaaatttaatttgtatggaactttaattaataatttttttaatcttaggtatttgcttgtggtagcattttttacaagtata |
3675436 |
T |
 |
| Q |
120 |
tacacaggaagccaagtgtatcgtcaaattcatgaacttatcactgggaataatatatttcgacctacaactgcagctgtgattgat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675435 |
tacacaggaagccaagtgtatcgtcaaattcatgaacttatcactgggaataatatatttcgacctacaactgcagctgtgattgat |
3675349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University