View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11557A_low_418 (Length: 220)

Name: NF11557A_low_418
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11557A_low_418
NF11557A_low_418
[»] chr4 (1 HSPs)
chr4 (13-197)||(54978146-54978333)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 197
Target Start/End: Complemental strand, 54978333 - 54978146
Alignment:
13 gaagaatatcaaaaccgcattcatcacgcatcaattcagagtcacaaccccaaatagcacatctagaactttttgccccggccatatgtggatgcttgtc 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
54978333 gaagaatatcaaaaccgcattcatcacgcatcaattcagagtcacaaccccaaatagcacatctagaactttttgccccggccatatgtggatggttgtc 54978234  T
113 caaaccgttactcaactttctacgcttatggtt---gtcgaatctttctggcgaatccattggttggttatcaggagttggtggtgtc 197  Q
    |||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||    
54978233 caaaccgttactcaactttctacgcttatggttgcagtcgaatctttctggcgaatccattggttggttatcaggagttggtggtgtc 54978146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University