View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_424 (Length: 218)
Name: NF11557A_low_424
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_424 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 39 - 198
Target Start/End: Original strand, 37809090 - 37809249
Alignment:
| Q |
39 |
aatataaagttgaagatgatccactctcttccgacggaaatgcaaatcgagaactataagcaacgaatgtcttgttttcagcttgttcttctatctcatg |
138 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809090 |
aatataaagttgaagatgacccactctcttccgacggaaatgcaaatcgagaactataagcaacgaatgtcttgttttcagcttgttcttctatctcatg |
37809189 |
T |
|
| Q |
139 |
attcccttctactaccattacagggacactggaaatcaatggttccatgtacctgaataa |
198 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809190 |
attcccttctactaccattaccgggacactggaaatcaatggttccatgtacctgaataa |
37809249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 39 - 196
Target Start/End: Original strand, 37816504 - 37816661
Alignment:
| Q |
39 |
aatataaagttgaagatgatccactctcttccgacggaaatgcaaatcgagaactataagcaacgaatgtcttgttttcagcttgttcttctatctcatg |
138 |
Q |
| |
|
|||| ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37816504 |
aatagaaagtggatgatgatccactctcttctgacggaaatgcaaatcgagaactataagcaacgaatgtcttgttttcagcttgttcttctatctcatg |
37816603 |
T |
|
| Q |
139 |
attcccttctactaccattacagggacactggaaatcaatggttccatgtacctgaat |
196 |
Q |
| |
|
||||||||| |||||||||| |||||||| | ||||| |||||||||||||||||| |
|
|
| T |
37816604 |
attcccttccactaccattattgggacactagcaatcagaggttccatgtacctgaat |
37816661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University