View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11557A_low_455 (Length: 208)

Name: NF11557A_low_455
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11557A_low_455
NF11557A_low_455
[»] chr4 (1 HSPs)
chr4 (29-188)||(31828144-31828303)


Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 29 - 188
Target Start/End: Original strand, 31828144 - 31828303
Alignment:
29 ttatggagcatttggaaggcgagaaacgctnnnnnnnntcaggacaaaaaggtctcaactgataagattgtagatcaagtcggattactctcttggaact 128  Q
    ||||||||||||||||||||||||||||||        |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||    
31828144 ttatggagcatttggaaggcgagaaacgctaaaaaaattcaggacaaaaaggtctcgactgataagattgtagatcaagtcagattactctcttggaact 31828243  T
129 ggttaacaaaatccacaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttg 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31828244 ggttaacaaaatccacaatcttcaaatatgaactggatcagtggtggtcgtgtcctcttg 31828303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University