View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_467 (Length: 204)
Name: NF11557A_low_467
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_467 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 21 - 184
Target Start/End: Original strand, 3006556 - 3006720
Alignment:
| Q |
21 |
atataattcttcataacttgataag-gaaaccattaattgcttcttatatggccatgagatacgatctccttgtaccttaaacacataactaattgtgct |
119 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3006556 |
atattattcttcataacttgataaaagaaaccattaattgcttcttatatggccatgagatacgatctccttgtaccttaaacacataactaattgtgct |
3006655 |
T |
|
| Q |
120 |
cctcctatcaattttatctccacactagtcaccatcagaatagccctactagattaagttgttca |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3006656 |
cctcctatcaattttatctccacactagtcaccatcagaatagtcctactagattaagttgttca |
3006720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University