View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11557A_low_468 (Length: 204)
Name: NF11557A_low_468
Description: NF11557A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11557A_low_468 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 31 - 160
Target Start/End: Complemental strand, 47358771 - 47358642
Alignment:
| Q |
31 |
attacatgatgagtaccctaaagttttgctattatagataaacataaacatgcatgcatgtggttcatcatcactgtccttttaggccatctctggtggg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47358771 |
attacatgatgagtaccctaaagttttgctattatagataaacataaacatgcatgcatgtggttcatcatcactgtccttttaggccatctctggtggg |
47358672 |
T |
 |
| Q |
131 |
tctgcctgacttgtaaagctttgtacaaat |
160 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
47358671 |
tctgcctgacttgtaaagctttgtataaat |
47358642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University